b2494 Gene Page
Genbank name: b2494
EcoGene name: yfgC
Divergent gene: yfgO
Species with an ortholog:
EC SP ST VC
EcoGene link: EG14199
Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 9.93
Model logo: b2494.1.model.LGO.gif
Sequence logo: b2494.1.LGO.gif
Sequence Alignment: b2494.1.ALGN
Solution location in genomic coordinates: 2613923-2613946
Solution sequence with flanking nucleotides: cctca AGAGCGGGATTGCGATCCGCAATT gtatc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC SP ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 9.17
Model logo: b2494.2.model.LGO.gif
Sequence logo: b2494.2.LGO.gif
Sequence Alignment: b2494.2.ALGN
Solution location in genomic coordinates: 2613979-2613999
Solution sequence with flanking nucleotides: gcttt TTATGACGGATTCAGGAAACT gaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2614023-2614043
Solution sequence with flanking nucleotides: gctaa TCTTCGCCGTTACACTCAAAG gcggc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.14
Model logo: b2494.3.model.LGO.gif
Sequence logo: b2494.3.LGO.gif
Sequence Alignment: b2494.3.ALGN
Solution location in genomic coordinates: 2613951-2613974
Solution sequence with flanking nucleotides: tgtat CGAAATGTCACAAAAAAGACTTCG ctttt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page