b2496 Gene Page

Genbank name: b2496
EcoGene name: yfgE
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   YP   
EcoGene link: EG14201

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 13.98
Model logo: b2496.1.model.LGO.gif
Sequence logo: b2496.1.LGO.gif
Sequence Alignment: b2496.1.ALGN
Solution location in genomic coordinates: 2616862-2616882 R
Solution sequence with flanking nucleotides: accga CCGGGCAGTGTTGCTGCCCGG ttcaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 2.06
Model logo: b2496.2.model.LGO.gif
Sequence logo: b2496.2.LGO.gif
Sequence Alignment: b2496.2.ALGN
Solution location in genomic coordinates: 2616842-2616859 R
Solution sequence with flanking nucleotides: cggtt CAAACATCATGGGATTCT
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page