b2511 Gene Page

Genbank name: b2511
EcoGene name: yfgK
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG14207

Species that contributed to the solution: AA EC ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 15.31
Model logo: b2511.1.model.LGO.gif
Sequence logo: b2511.1.LGO.gif
Sequence Alignment: b2511.1.ALGN
Solution location in genomic coordinates: 2635466-2635489 R
Solution sequence with flanking nucleotides: atcgt CTCTGTCGTTCACTTTGAAAACGG ctcct
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfgK_yfgL_IR Overlap: 8
Solution location in genomic coordinates: 2635428-2635451 R
Solution sequence with flanking nucleotides: agggg CCGTTTTCCTGTTTTTAACAACGA cgcga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yfgK_yfgL_IR Overlap: 8

Gene Index Page