b2531 Gene Page

Solution location in genomic coordinates: 2660236-2660258 R
Solution sequence with flanking nucleotides: gtaaa TAGTTGACCAATTTACTCGGGAA tgtca
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: AA EC HI PA SP ST TF VC YP
Total number of sites in the solution: 15
Number of E. coli sites in the solution: 2
Map value: 67.80
Model logo: b2531.2.model.LGO.gif
Sequence logo: b2531.2.LGO.gif
Sequence Alignment: b2531.2.ALGN
Solution location in genomic coordinates: 2660271-2660286 R
Solution sequence with flanking nucleotides: aggtt AAATACCCGACTAAAT cagtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2660246-2660261 R
Solution sequence with flanking nucleotides: caagt AAATAGTTGACCAATT tactc
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC PA
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 12.38
Model logo: b2531.3.model.LGO.gif
Sequence logo: b2531.3.LGO.gif
Sequence Alignment: b2531.3.ALGN
Solution location in genomic coordinates: 2660425-2660444 R
Solution sequence with flanking nucleotides: gtcgg ATAAGGCGTTCACGCCGCAT ccgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP184c     Overlap: 20
Solution location in genomic coordinates: 2660334-2660353 R
Solution sequence with flanking nucleotides: ggcgg ATATGGCGTTCACGCCGCAT ccgac
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP184a     Overlap: 20


Gene Index Page