b2532 Gene Page

Genbank name: b2532
EcoGene name: yfhQ
Divergent gene: suhB
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG13452

Species that contributed to the solution: AA EC PA SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 33.20
Model logo: b2532.1.model.LGO.gif
Sequence logo: b2532.1.LGO.gif
Sequence Alignment: b2532.1.ALGN
Solution location in genomic coordinates: 2661429-2661451 R
Solution sequence with flanking nucleotides: tctct CACTGGATGTTAAAGAACGGGAA aacgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 15.91
Model logo: b2532.2.model.LGO.gif
Sequence logo: b2532.2.LGO.gif
Sequence Alignment: b2532.2.ALGN
Solution location in genomic coordinates: 2661360-2661378 R
Solution sequence with flanking nucleotides: atgat AAGATGCGTGAATAATCTT tagat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.05
Model logo: b2532.3.model.LGO.gif
Sequence logo: b2532.3.LGO.gif
Sequence Alignment: b2532.3.ALGN
Solution location in genomic coordinates: 2661344-2661359 R
Solution sequence with flanking nucleotides: atctt TAGATGAAGAAAGACA
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page