b2595 Gene Page

Genbank name: b2595
EcoGene name: yfiO
Divergent gene: rluD
Species with an ortholog: EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG14222

Species that contributed to the solution: EC HI PA ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 28.80
Model logo: b2595.1.model.LGO.gif
Sequence logo: b2595.1.LGO.gif
Sequence Alignment: b2595.1.ALGN
Solution location in genomic coordinates: 2734077-2734100
Solution sequence with flanking nucleotides: tgccg TTTAATATAGTGTGCTATTGTAGC tggtc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 25.34
Model logo: b2595.2.model.LGO.gif
Sequence logo: b2595.2.LGO.gif
Sequence Alignment: b2595.2.ALGN
Solution location in genomic coordinates: 2734072-2734093
Solution sequence with flanking nucleotides: ggctt TGCCGTTTAATATAGTGTGCTA ttgta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2734132-2734153
Solution sequence with flanking nucleotides: gaatc TCCCGTATTACATTTTGAGGAA agtca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 15.74
Model logo: b2595.3.model.LGO.gif
Sequence logo: b2595.3.LGO.gif
Sequence Alignment: b2595.3.ALGN
Solution location in genomic coordinates: 2734101-2734118
Solution sequence with flanking nucleotides: gtagc TGGTCTTAACCGGGAGCA ggaac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page