b2619 Gene Page

Genbank name: b2619
EcoGene name: yfjG
Divergent gene: smpB
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG13193

Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 8.56
Model logo: b2619.1.model.LGO.gif
Sequence logo: b2619.1.LGO.gif
Sequence Alignment: b2619.1.ALGN
Solution location in genomic coordinates: 2752881-2752904 R
Solution sequence with flanking nucleotides: gtgaa TCATCGGTAATCTGAAATCGAAAA caccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 6.38
Model logo: b2619.2.model.LGO.gif
Sequence logo: b2619.2.LGO.gif
Sequence Alignment: b2619.2.ALGN
Solution location in genomic coordinates: 2752786-2752804 R
Solution sequence with flanking nucleotides: agcgt TTTTTTTACAGCAGGATAA
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 6.18
Model logo: b2619.3.model.LGO.gif
Sequence logo: b2619.3.LGO.gif
Sequence Alignment: b2619.3.ALGN
Solution location in genomic coordinates: 2752809-2752827 R
Solution sequence with flanking nucleotides: ccgat GTTACCCAGCGCCGGGATA gcgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2752786-2752804 R
Solution sequence with flanking nucleotides: agcgt TTTTTTTACAGCAGGATAA
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page