b2670 Gene Page

Repeat: stpA_TERM38_IR     Overlap: 20
Solution location in genomic coordinates: 2797058-2797079
Solution sequence with flanking nucleotides: taaat AAAAATTTTTCACTAATTGATT agtca
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 8.68
Model logo: b2670.2.model.LGO.gif
Sequence logo: b2670.2.LGO.gif
Sequence Alignment: b2670.2.ALGN
Solution location in genomic coordinates: 2796763-2796783
Solution sequence with flanking nucleotides: aaatc AAAGTGAATAAAAATGCAATA taaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2796961-2796981
Solution sequence with flanking nucleotides: taatt GATTTAATTAAAAATAAATCA tatcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: stpA_TERM38_IR     Overlap: 21

---

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 6.90
Model logo: b2670.3.model.LGO.gif
Sequence logo: b2670.3.LGO.gif
Sequence Alignment: b2670.3.ALGN
Solution location in genomic coordinates: 2796956-2796978
Solution sequence with flanking nucleotides: atatc TAATTGATTTAATTAAAAATAAA tcata
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: stpA_TERM38_IR     Overlap: 19
Solution location in genomic coordinates: 2797034-2797056
Solution sequence with flanking nucleotides: aatat TTTATCTACAAAAACTGACTAAA taaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: TERM45     Overlap: 4


Gene Index Page