b2740 Gene Page
Genbank name: b2740
EcoGene name: ygbN
Divergent gene:
Species with an ortholog:
AA EC PA ST VC YP
EcoGene link: EG13108
Species that contributed to the solution: AA EC VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 30.53
Model logo: b2740.1.model.LGO.gif
Sequence logo: b2740.1.LGO.gif
Sequence Alignment: b2740.1.ALGN
Solution location in genomic coordinates: 2863092-2863107
Solution sequence with flanking nucleotides: ggggt AGGTTAACTATAACTT tcaga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 6.14
Model logo: b2740.2.model.LGO.gif
Sequence logo: b2740.2.LGO.gif
Sequence Alignment: b2740.2.ALGN
Solution location in genomic coordinates: 2863051-2863071
Solution sequence with flanking nucleotides: cccta ATTACAACGTACCCATACATC ccccc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page