b2748 Gene Page

Genbank name: b2748
EcoGene name: ygbQ
Divergent gene:
Species with an ortholog: EC ST VC YP
EcoGene link: EG13111

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 17.26
Model logo: b2748.1.model.LGO.gif
Sequence logo: b2748.1.LGO.gif
Sequence Alignment: b2748.1.ALGN
Solution location in genomic coordinates: 2870926-2870948 R
Solution sequence with flanking nucleotides: acaat GGACAAATGTGGTACATTTGCCC gcgtt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2870852-2870874 R
Solution sequence with flanking nucleotides: tgcat GGGATGATGATGCCGTTTTTCAG ggggc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.68
Model logo: b2748.2.model.LGO.gif
Sequence logo: b2748.2.LGO.gif
Sequence Alignment: b2748.2.ALGN
Solution location in genomic coordinates: 2870987-2871010 R
Solution sequence with flanking nucleotides: tgttc ATAATTCAAACCGTAACTAATAAT gagat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.73
Model logo: b2748.3.model.LGO.gif
Sequence logo: b2748.3.LGO.gif
Sequence Alignment: b2748.3.ALGN
Solution location in genomic coordinates: 2870908-2870925 R
Solution sequence with flanking nucleotides: tgccc GCGTTGTCGCGGTATCCC caaca
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page