b2810 Gene Page

Genbank name: b2810
EcoGene name: csdA
Divergent gene: ygdI
Species with an ortholog: AA   EC   HI   ST   VC   YP   
EcoGene link: EG13082

Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 10.46
Model logo: b2810.1.model.LGO.gif
Sequence logo: b2810.1.LGO.gif
Sequence Alignment: b2810.1.ALGN
Solution location in genomic coordinates: 2941200-2941221
Solution sequence with flanking nucleotides: tctta ATAGTATTGATTAACAGGCTAA aatta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2941264-2941285
Solution sequence with flanking nucleotides: gcggc TTCGCCAGGATATCCAGATAAT tctga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.94
Model logo: b2810.2.model.LGO.gif
Sequence logo: b2810.2.LGO.gif
Sequence Alignment: b2810.2.ALGN
Solution location in genomic coordinates: 2941226-2941248
Solution sequence with flanking nucleotides: aaatt AACGCCTAACACTATTCAGCATA tgtta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 9.79
Model logo: b2810.3.model.LGO.gif
Sequence logo: b2810.3.LGO.gif
Sequence Alignment: b2810.3.ALGN
Solution location in genomic coordinates: 2941291-2941314
Solution sequence with flanking nucleotides: tctga TGGTTAGCACTCTCCTTGTATCAA agtga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page