b2832 Gene Page

Genbank name: b2832
EcoGene name: ygdQ
Divergent gene:
Species with an ortholog: AA EC HI PA ST YP
EcoGene link: EG13092

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.08
Model logo: b2832.1.model.LGO.gif
Sequence logo: b2832.1.LGO.gif
Sequence Alignment: b2832.1.ALGN
Solution location in genomic coordinates: 2968403-2968425
Solution sequence with flanking nucleotides: cgggc ATATAATTACCGCTTCATTTTTT tggca
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 7.83
Model logo: b2832.2.model.LGO.gif
Sequence logo: b2832.2.LGO.gif
Sequence Alignment: b2832.2.ALGN
Solution location in genomic coordinates: 2968371-2968388
Solution sequence with flanking nucleotides: TAGCCATCGCTTTGACCT gccgc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page