b2834 Gene Page

Genbank name: b2834
EcoGene name: tas
Divergent gene:
Species with an ortholog: EC PA SP ST VC YP
EcoGene link: EG13093

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 6.10
Model logo: b2834.1.model.LGO.gif
Sequence logo: b2834.1.LGO.gif
Sequence Alignment: b2834.1.ALGN
Solution location in genomic coordinates: 2969583-2969605
Solution sequence with flanking nucleotides: tttta TATTCCTTATGTCGTGATTATAA aaagg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.49
Model logo: b2834.2.model.LGO.gif
Sequence logo: b2834.2.LGO.gif
Sequence Alignment: b2834.2.ALGN
Solution location in genomic coordinates: 2969521-2969543
Solution sequence with flanking nucleotides: taagg TCAGCATCCGGCTGGCCTTAAGA ttttt
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2969560-2969582
Solution sequence with flanking nucleotides: ccctt TTCCCTTCCCTCTGCCATTTTTA tattc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page