b2899 Gene Page

Genbank name: b2899
EcoGene name: yqfA
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG13077

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 44.74
Model logo: b2899.1.model.LGO.gif
Sequence logo: b2899.1.LGO.gif
Sequence Alignment: b2899.1.ALGN
Solution location in genomic coordinates: 3041307-3041330 R
Solution sequence with flanking nucleotides: taaa TTGAACTCACGCCTGTTAGTTGAA atttc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3041229-3041252 R
Solution sequence with flanking nucleotides: tttat TTTAGCTAACAGGTGTTCACTGGA actat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST TF VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 14.54
Model logo: b2899.2.model.LGO.gif
Sequence logo: b2899.2.LGO.gif
Sequence Alignment: b2899.2.ALGN
Solution location in genomic coordinates: 3041236-3041252 R
Solution sequence with flanking nucleotides: tttat TTTAGCTAACAGGTGTT cactg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3041200-3041216 R
Solution sequence with flanking nucleotides: tcagt TACGCTGGAGAGGTATA catgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 9.61
Model logo: b2899.3.model.LGO.gif
Sequence logo: b2899.3.LGO.gif
Sequence Alignment: b2899.3.ALGN
Solution location in genomic coordinates: 3041171-3041186 R
Solution sequence with flanking nucleotides: tgtac GTTTCTCCGGAGTAAG tt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page