b2970 Gene Page

Genbank name: b2970
EcoGene name: yghF
Divergent gene:
Species with an ortholog: EC SP VC
EcoGene link: EG12990

Species that contributed to the solution: EC SP VC
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.61
Model logo: b2970.1.model.LGO.gif
Sequence logo: b2970.1.LGO.gif
Sequence Alignment: b2970.1.ALGN
Solution location in genomic coordinates: 3111025-3111045 R
Solution sequence with flanking nucleotides: ttcgt GACGCACGAATTTATCTCATT caatg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yghF_yghG_IR Overlap: 16

Species that contributed to the solution: EC VC
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 2.13
Model logo: b2970.2.model.LGO.gif
Sequence logo: b2970.2.LGO.gif
Sequence Alignment: b2970.2.ALGN
Solution location in genomic coordinates: 3110968-3110983 R
Solution sequence with flanking nucleotides: agaca ATCTCTTAATACAGAC aaaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 1.25
Model logo: b2970.3.model.LGO.gif
Sequence logo: b2970.3.LGO.gif
Sequence Alignment: b2970.3.ALGN
Solution location in genomic coordinates: 3111023-3111046 R
Solution sequence with flanking nucleotides: tttcg TGACGCACGAATTTATCTCATTCA atggc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yghF_yghG_IR Overlap: 18
Solution location in genomic coordinates: 3110998-3111021 R
Solution sequence with flanking nucleotides: ttcaa TGGCTGACAAAAATTCGTCACACT cttaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yghF_yghG_IR Overlap: 18

Gene Index Page