b2989 Gene Page

Genbank name: b2989
EcoGene name: yghU
Divergent gene: gsp
Species with an ortholog: EC ST TF YP
EcoGene link: EG13005

Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 9.13
Model logo: b2989.1.model.LGO.gif
Sequence logo: b2989.1.LGO.gif
Sequence Alignment: b2989.1.ALGN
Solution location in genomic coordinates: 3136564-3136587
Solution sequence with flanking nucleotides: accta AGCAGTTGGCGTAATTGTTGTGCT ctgat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3136619-3136642
Solution sequence with flanking nucleotides: cggac AGAGGTCAGACTAATCATACACCT catcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 6.62
Model logo: b2989.2.model.LGO.gif
Sequence logo: b2989.2.LGO.gif
Sequence Alignment: b2989.2.ALGN
Solution location in genomic coordinates: 3136596-3136616
Solution sequence with flanking nucleotides: attac CTGCTCAGCGACATTAACCGG acaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 4.13
Model logo: b2989.3.model.LGO.gif
Sequence logo: b2989.3.LGO.gif
Sequence Alignment: b2989.3.ALGN
Solution location in genomic coordinates: 3136660-3136677
Solution sequence with flanking nucleotides: tggcg CAAAGGGTTAAAAAATTC acatt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page