b2997 Gene Page

Genbank name: b2997
EcoGene name: hybO
Divergent gene:
Species with an ortholog: EC SP ST TF
EcoGene link: EG13006

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 14.76
Model logo: b2997.1.model.LGO.gif
Sequence logo: b2997.1.LGO.gif
Sequence Alignment: b2997.1.ALGN
Solution location in genomic coordinates: 3144429-3144446 R
Solution sequence with flanking nucleotides: ttatc TTGCTTTAATTAATTACA ctaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 13.96
Model logo: b2997.2.model.LGO.gif
Sequence logo: b2997.2.LGO.gif
Sequence Alignment: b2997.2.ALGN
Solution location in genomic coordinates: 3144309-3144332 R
Solution sequence with flanking nucleotides: attat TGATTTTGCGATTGAGGCAAAATA tatgc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3144280-3144303 R
Solution sequence with flanking nucleotides: tatgc CAGGTCTTCGCAACGGAATAACTA taa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 12.47
Model logo: b2997.3.model.LGO.gif
Sequence logo: b2997.3.LGO.gif
Sequence Alignment: b2997.3.ALGN
Solution location in genomic coordinates: 3144447-3144466 R
Solution sequence with flanking nucleotides: t GATCAAACATACGTATTATC ttgct
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page