b3050 Gene Page

Genbank name: b3050
EcoGene name: yqiJ
Divergent gene: glgS
Species with an ortholog: EC   SP   ST   
EcoGene link: EG14231

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 5.33
Model logo: b3050.1.model.LGO.gif
Sequence logo: b3050.1.LGO.gif
Sequence Alignment: b3050.1.ALGN
Solution location in genomic coordinates: 3189995-3190016
Solution sequence with flanking nucleotides: gccat ATGCTTTTTCTGATTTCAGTAT tcccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 5.19
Model logo: b3050.2.model.LGO.gif
Sequence logo: b3050.2.LGO.gif
Sequence Alignment: b3050.2.ALGN
Solution location in genomic coordinates: 3189994-3190017
Solution sequence with flanking nucleotides: ggcca TATGCTTTTTCTGATTTCAGTATT cccca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3190058-3190081
Solution sequence with flanking nucleotides: gtaaa TATATTGTCCCCGATCACACTTTT tagtg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 5.15
Model logo: b3050.3.model.LGO.gif
Sequence logo: b3050.3.LGO.gif
Sequence Alignment: b3050.3.ALGN
Solution location in genomic coordinates: 3190039-3190061
Solution sequence with flanking nucleotides: gcctt TAAACATAACGTGCGTAAATATA ttgtc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3190187-3190209
Solution sequence with flanking nucleotides: caaag TAAATATTGCGTCACTAAATGGA cattg
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page