b3052 Gene Page

Genbank name: b3052
EcoGene name: rfaE
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG13416

Species that contributed to the solution: EC HI SP ST TF YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 20.57
Model logo: b3052.1.model.LGO.gif
Sequence logo: b3052.1.LGO.gif
Sequence Alignment: b3052.1.ALGN
Solution location in genomic coordinates: 3194416-3194433 R
Solution sequence with flanking nucleotides: atggt ATTATCGCGCGCAAATTT tgaat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.72
Model logo: b3052.2.model.LGO.gif
Sequence logo: b3052.2.LGO.gif
Sequence Alignment: b3052.2.ALGN
Solution location in genomic coordinates: 3194395-3194414 R
Solution sequence with flanking nucleotides: atttt GAATCTCTCAGGAGACAGGA
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page