b4140 Gene Page
Genbank name: b4140
EcoGene name: fxsA
Divergent gene: aspA
Species with an ortholog:
EC ST VC YP
EcoGene link: EG12382
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 14.01
Model logo: b4140.1.model.LGO.gif
Sequence logo: b4140.1.LGO.gif
Sequence Alignment: b4140.1.ALGN
Solution location in genomic coordinates: 4366089-4366112
Solution sequence with flanking nucleotides: ttatt AATTTGTGAAATAGATCACCGCTT tggga
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4366150-4366173
Solution sequence with flanking nucleotides: tcttg AAATTTTGCTAATGACCACAATAT aagct
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.89
Model logo: b4140.2.model.LGO.gif
Sequence logo: b4140.2.LGO.gif
Sequence Alignment: b4140.2.ALGN
Solution location in genomic coordinates: 4366293-4366312
Solution sequence with flanking nucleotides: agatt TCAATCTTTATTCAGGTTGC ccatg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 11.80
Model logo: b4140.3.model.LGO.gif
Sequence logo: b4140.3.LGO.gif
Sequence Alignment: b4140.3.ALGN
Solution location in genomic coordinates: 4366017-4366035
Solution sequence with flanking nucleotides: ccgag ATCATATGCTGCTTGAGGA tttct
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4366041-4366059
Solution sequence with flanking nucleotides: tttct ACCGTAATCTGGATCACTT taagt
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page