b4256 Gene Page

Genbank name: b4256
EcoGene name: yjgM
Divergent gene: yjgN
Species with an ortholog: EC SP ST YP
EcoGene link: EG12532

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 19.90
Model logo: b4256.1.model.LGO.gif
Sequence logo: b4256.1.LGO.gif
Sequence Alignment: b4256.1.ALGN
Solution location in genomic coordinates: 4476968-4476991 R
Solution sequence with flanking nucleotides: taccg CTGATAAAGGCTACACCGTCGCCG atccg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.98
Model logo: b4256.2.model.LGO.gif
Sequence logo: b4256.2.LGO.gif
Sequence Alignment: b4256.2.ALGN
Solution location in genomic coordinates: 4476992-4477009 R
Solution sequence with flanking nucleotides: atccg CCGAATACGGTCTTACCG ctgat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 13.35
Model logo: b4256.3.model.LGO.gif
Sequence logo: b4256.3.LGO.gif
Sequence Alignment: b4256.3.ALGN
Solution location in genomic coordinates: 4476992-4477009 R
Solution sequence with flanking nucleotides: atccg CCGAATACGGTCTTACCG ctgat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4476974-4476991 R
Solution sequence with flanking nucleotides: taccg CTGATAAAGGCTACACCG tcgcc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page