bacA Gene Page

Genbank name: bacA
EcoGene name: bacA
Divergent gene:
Species with an ortholog: EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG11665

Species that contributed to the solution: EC SP ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 7.77
Model logo: bacA.1.model.LGO.gif
Sequence logo: bacA.1.LGO.gif
Sequence Alignment: bacA.1.ALGN
Solution location in genomic coordinates: 3201843-3201864 R
Solution sequence with flanking nucleotides: TAATTTTACAGCTGTTAAACCA aacgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 2.86
Model logo: bacA.2.model.LGO.gif
Sequence logo: bacA.2.LGO.gif
Sequence Alignment: bacA.2.ALGN
Solution location in genomic coordinates: 3201774-3201793 R
Solution sequence with flanking nucleotides: cattt TAATAATTTAGGGGTTTATT g
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 1.01
Model logo: bacA.3.model.LGO.gif
Sequence logo: bacA.3.LGO.gif
Sequence Alignment: bacA.3.ALGN
Solution location in genomic coordinates: 3201812-3201835 R
Solution sequence with flanking nucleotides: cggtt ATAACCTGGTCATACGCAGTAGTT cggac
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page