betT Gene Page

Genbank name: betT
EcoGene name: betT
Divergent gene: betI
Species with an ortholog: EC   HI   PA   VC   YP   
EcoGene link: EG10112

Species that contributed to the solution: EC HI PA VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 24.86
Model logo: betT.1.model.LGO.gif
Sequence logo: betT.1.LGO.gif
Sequence Alignment: betT.1.ALGN
Solution location in genomic coordinates: 328601-328624
Solution sequence with flanking nucleotides: aagcg GTTATTGATTGGACGTTCAATATA aaatg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 328634-328657
Solution sequence with flanking nucleotides: gtgtc TTAATTGTTACGAATTTGATTTTA aatag
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: betI_betT_IR     Overlap: 23

Species that contributed to the solution: EC VC YP
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 2.35
Model logo: betT.2.model.LGO.gif
Sequence logo: betT.2.LGO.gif
Sequence Alignment: betT.2.ALGN
Solution location in genomic coordinates: 328583-328600
Solution sequence with flanking nucleotides: agcgg TGTTTATCTATTAAAGCG gttat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI PA VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: -1.90
Model logo: betT.3.model.LGO.gif
Sequence logo: betT.3.LGO.gif
Sequence Alignment: betT.3.ALGN
Solution location in genomic coordinates: 328564-328580
Solution sequence with flanking nucleotides: tttcg CCACTCCATTCATCAGC ggtgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page