bioA Gene Page

Genbank name: bioA
EcoGene name: bioA
Divergent gene: bioB
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10117

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 22.55
Model logo: bioA.1.model.LGO.gif
Sequence logo: bioA.1.LGO.gif
Sequence Alignment: bioA.1.ALGN
Solution location in genomic coordinates: 808508-808527 R
Solution sequence with flanking nucleotides: tcggt GTAGACTTGTAAACCTAAAT ctttt
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: bioA_bioB_IR Overlap: 19
Solution location in genomic coordinates: 808482-808501 R
Solution sequence with flanking nucleotides: ttttc AATTTGGTTTACAAGTCGAT t
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: bioA_bioB_IR Overlap: 19

Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 15.26
Model logo: bioA.2.model.LGO.gif
Sequence logo: bioA.2.LGO.gif
Sequence Alignment: bioA.2.ALGN
Solution location in genomic coordinates: 808537-808560 R
Solution sequence with flanking nucleotides: gggct TCTCCAAAACGTGTTTTTTGTTGT taatt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 12.36
Model logo: bioA.3.model.LGO.gif
Sequence logo: bioA.3.LGO.gif
Sequence Alignment: bioA.3.ALGN
Solution location in genomic coordinates: 808496-808518 R
Solution sequence with flanking nucleotides: acttg TAAACCTAAATCTTTTCAATTTG gttta
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: bioA_bioB_IR Overlap: 23

Gene Index Page