bioB Gene Page

Genbank name: bioB
EcoGene name: bioB
Divergent gene: bioA
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10118

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 30.19
Model logo: bioB.1.model.LGO.gif
Sequence logo: bioB.1.LGO.gif
Sequence Alignment: bioB.1.ALGN
Solution location in genomic coordinates: 808482-808501
Solution sequence with flanking nucleotides: a ATCGACTTGTAAACCAAATT gaaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: bioA_bioB_IR Overlap: 19
Solution location in genomic coordinates: 808508-808527
Solution sequence with flanking nucleotides: aaaag ATTTAGGTTTACAAGTCTAC accga
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: bioA_bioB_IR Overlap: 19

Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 9.60
Model logo: bioB.2.model.LGO.gif
Sequence logo: bioB.2.LGO.gif
Sequence Alignment: bioB.2.ALGN
Solution location in genomic coordinates: 808537-808560
Solution sequence with flanking nucleotides: aatta ACAACAAAAAACACGTTTTGGAGA agccc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page