bioH Gene Page

Genbank name: bioH
EcoGene name: bioH
Divergent gene: yhgH
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG10122

Species that contributed to the solution: EC PA ST TF VC
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 19.07
Model logo: bioH.1.model.LGO.gif
Sequence logo: bioH.1.LGO.gif
Sequence Alignment: bioH.1.ALGN
Solution location in genomic coordinates: 3542887-3542906 R
Solution sequence with flanking nucleotides: taaat CCCCGACGCCAGTGACGCCG ctgcc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 14.73
Model logo: bioH.2.model.LGO.gif
Sequence logo: bioH.2.LGO.gif
Sequence Alignment: bioH.2.ALGN
Solution location in genomic coordinates: 3542552-3542568 R
Solution sequence with flanking nucleotides: tgacc TAACGCCAGTGGCATTC ggcat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3542522-3542538 R
Solution sequence with flanking nucleotides: cagca TAATCCCGGTACTGTTA gcata
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST TF VC
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 2
Map value: 14.60
Model logo: bioH.3.model.LGO.gif
Sequence logo: bioH.3.LGO.gif
Sequence Alignment: bioH.3.ALGN
Solution location in genomic coordinates: 3542885-3542905 R
Solution sequence with flanking nucleotides: aaatc CCCGACGCCAGTGACGCCGCT gccat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3542666-3542686 R
Solution sequence with flanking nucleotides: cggtt TTTGCAGGCAGCGACCGCAGG gaaga
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page