bisC Gene Page

Genbank name: bisC
EcoGene name: bisC
Divergent gene: yiaD
Species with an ortholog: AA EC HI ST VC
EcoGene link: EG10124

Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 24.91
Model logo: bisC.1.model.LGO.gif
Sequence logo: bisC.1.LGO.gif
Sequence Alignment: bisC.1.ALGN
Solution location in genomic coordinates: 3713968-3713990 R
Solution sequence with flanking nucleotides: ttctg ACTGCCGCCCATTGGGGGCCCAT gctgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 10.72
Model logo: bisC.2.model.LGO.gif
Sequence logo: bisC.2.LGO.gif
Sequence Alignment: bisC.2.ALGN
Solution location in genomic coordinates: 3714083-3714102 R
Solution sequence with flanking nucleotides: atgaa GATTATTCCTGGGAATACTC ggaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 8.20
Model logo: bisC.3.model.LGO.gif
Sequence logo: bisC.3.LGO.gif
Sequence Alignment: bisC.3.ALGN
Solution location in genomic coordinates: 3714111-3714133 R
Solution sequence with flanking nucleotides: gttcc GTGGCGGGAGATTATGCCGCGTG aacat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3714053-3714075 R
Solution sequence with flanking nucleotides: aaatt TGTAAGTAATATTTAACTGCTCA ataca
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page