bolA Gene Page

Genbank name: bolA
EcoGene name: bolA
Divergent gene: yajG
Species with an ortholog: EC HI SP ST VC YP
EcoGene link: EG10125

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 11.18
Model logo: bolA.1.model.LGO.gif
Sequence logo: bolA.1.LGO.gif
Sequence Alignment: bolA.1.ALGN
Solution location in genomic coordinates: 453619-453641
Solution sequence with flanking nucleotides: gttaa GCTGCAATGGAAACGGTAAAAGC ggcta
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 10.64
Model logo: bolA.2.model.LGO.gif
Sequence logo: bolA.2.LGO.gif
Sequence Alignment: bolA.2.ALGN
Solution location in genomic coordinates: 453556-453573
Solution sequence with flanking nucleotides: tcttt AAATCAGTAAACTTCATA cgctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 10.32
Model logo: bolA.3.model.LGO.gif
Sequence logo: bolA.3.LGO.gif
Sequence Alignment: bolA.3.ALGN
Solution location in genomic coordinates: 453596-453616
Solution sequence with flanking nucleotides: aggac GAAACCTAAATATTTGTTGTT aagct
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page