brnQ Gene Page

Solution location in genomic coordinates: 418716-418738
Solution sequence with flanking nucleotides: ggagt ATTTCCCGCTAAAATTGTTTAAA tatac
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 13.45
Model logo: brnQ.2.model.LGO.gif
Sequence logo: brnQ.2.LGO.gif
Sequence Alignment: brnQ.2.ALGN
Solution location in genomic coordinates: 418449-418472
Solution sequence with flanking nucleotides: cgatg CTGGCTTATTTTCTTTGCAGTCAA aatac
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 418506-418529
Solution sequence with flanking nucleotides: ggtga TTTTTTGTTCGCATGATTAGCCAT gtctt
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 12.31
Model logo: brnQ.3.model.LGO.gif
Sequence logo: brnQ.3.LGO.gif
Sequence Alignment: brnQ.3.ALGN
Solution location in genomic coordinates: 418605-418624
Solution sequence with flanking nucleotides: atccc TCCTTGCTTTAAAACGTTAT aagcg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 418667-418686
Solution sequence with flanking nucleotides: ctgca TTAACGCGGTAAATCGAAAA actat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page