carA Gene Page
Genbank name: carA
EcoGene name: carA
Divergent gene:
Species with an ortholog:
EC PA SP ST TF VC YP
EcoGene link: EG10134
Reported site,genomic coordinates and site type: DPInteract 29602:29619 argR
Reported site,genomic coordinates and site type: DPInteract 29623:29640 argR
Reported site,genomic coordinates and site type: DPInteract 29602:29640 argR2
Reported site,genomic coordinates and site type: DPInteract 29364:29388 carP
Reported site,genomic coordinates and site type: DPInteract 29462:29486 carP
Reported site,genomic coordinates and site type: DPInteract 29410:29435 purR
Species that contributed to the solution: EC ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 21.42
Model logo: carA.1.model.LGO.gif
Sequence logo: carA.1.LGO.gif
Sequence Alignment: carA.1.ALGN
Solution location in genomic coordinates: 29604-29627
Solution sequence with flanking nucleotides: cattg TGAATTAATATGCAAATAAAGTGA gtgaa
Number of overlapping basepairs with reported site: 24
Site type: argR argR argR2
Species that contributed to the solution: EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 15.41
Model logo: carA.2.model.LGO.gif
Sequence logo: carA.2.LGO.gif
Sequence Alignment: carA.2.ALGN
Solution location in genomic coordinates: 29355-29378
Solution sequence with flanking nucleotides: atgta AATTTTGACCATTTGGTCCACTTT tttct
Number of overlapping basepairs with reported site: 15
Site type: carP
Species that contributed to the solution: EC PA SP ST VC YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 14.45
Model logo: carA.3.model.LGO.gif
Sequence logo: carA.3.LGO.gif
Sequence Alignment: carA.3.ALGN
Solution location in genomic coordinates: 29356-29378
Solution sequence with flanking nucleotides: tgtaa ATTTTGACCATTTGGTCCACTTT tttct
Number of overlapping basepairs with reported site: 15
Site type: carP
Solution location in genomic coordinates: 29501-29523
Solution sequence with flanking nucleotides: taaaa AATCCCGCCATTAAGTTGACTTT tagcg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page