cbl Gene Page

Genbank name: cbl
EcoGene name: cbl
Divergent gene:
Species with an ortholog: EC PA TF VC
EcoGene link: EG14264

Species that contributed to the solution: EC PA
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 3.44
Model logo: cbl.1.model.LGO.gif
Sequence logo: cbl.1.LGO.gif
Sequence Alignment: cbl.1.ALGN
Solution location in genomic coordinates: 2059000-2059021 R
Solution sequence with flanking nucleotides: ggatg GAATAAGATGCGGGTTTTTATT atttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.80
Model logo: cbl.2.model.LGO.gif
Sequence logo: cbl.2.LGO.gif
Sequence Alignment: cbl.2.ALGN
Solution location in genomic coordinates: 2058968-2058987 R
Solution sequence with flanking nucleotides: atgcc GGGCATTAGACTTTAACAAT aacgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC TF VC
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 1
Map value: 1.61
Model logo: cbl.3.model.LGO.gif
Sequence logo: cbl.3.LGO.gif
Sequence Alignment: cbl.3.ALGN
Solution location in genomic coordinates: 2058946-2058965 R
Solution sequence with flanking nucleotides: aataa CGGGAAATCTGAACTGCCCG gagtt
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page