cbpA Gene Page
Genbank name: cbpA
EcoGene name: cbpA
Divergent gene: yccE
Species with an ortholog:
EC ST TF
EcoGene link: EG12193
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 10.80
Model logo: cbpA.1.model.LGO.gif
Sequence logo: cbpA.1.LGO.gif
Sequence Alignment: cbpA.1.ALGN
Solution location in genomic coordinates: 1063057-1063080 R
Solution sequence with flanking nucleotides: tatga AATTTTGAGGATTACCCTACACTT atagg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1063024-1063047 R
Solution sequence with flanking nucleotides: gagtt ACCTTACAGGGGTTCCTTCAATTT gtgtt
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST TF
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 4.09
Model logo: cbpA.2.model.LGO.gif
Sequence logo: cbpA.2.LGO.gif
Sequence Alignment: cbpA.2.ALGN
Solution location in genomic coordinates: 1063047-1063067 R
Solution sequence with flanking nucleotides: ggatt ACCCTACACTTATAGGAGTTA cctta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1063015-1063035 R
Solution sequence with flanking nucleotides: agggg TTCCTTCAATTTGTGTTGATT tacgc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 2.36
Model logo: cbpA.3.model.LGO.gif
Sequence logo: cbpA.3.LGO.gif
Sequence Alignment: cbpA.3.ALGN
Solution location in genomic coordinates: 1063220-1063243 R
Solution sequence with flanking nucleotides: tataa AATTTAATAAATAATGACGCCCTA gttaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1063084-1063107 R
Solution sequence with flanking nucleotides: atttc AATAACATATTCTGTGTTGGCATA tgaaa
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cbpA_yccE_IR     Overlap: 11
Gene Index Page