cca Gene Page

Genbank name: cca
EcoGene name: cca
Divergent gene:
Species with an ortholog: AA   EC   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10136

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 9.07
Model logo: cca.1.model.LGO.gif
Sequence logo: cca.1.LGO.gif
Sequence Alignment: cca.1.ALGN
Solution location in genomic coordinates: 3199491-3199509
Solution sequence with flanking nucleotides: actgt CTTATTATTAGGAATTGTG tattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 5.92
Model logo: cca.2.model.LGO.gif
Sequence logo: cca.2.LGO.gif
Sequence Alignment: cca.2.ALGN
Solution location in genomic coordinates: 3199467-3199490
Solution sequence with flanking nucleotides: t AAATCGCCTTCTTCGTTGCACTGT cttat
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page