cdd Gene Page
Genbank name: cdd
EcoGene name: cdd
Divergent gene:
Species with an ortholog:
EC HI SP ST VC YP
EcoGene link: EG10137
Reported site,genomic coordinates and site type: DPInteract 2229736:2229757 crp
Reported site,genomic coordinates and site type: DPInteract 2229786:2229807 crp
Reported site,genomic coordinates and site type: DPInteract 2229766:2229783 cytR
Species that contributed to the solution: EC HI ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 38.25
Model logo: cdd.1.model.LGO.gif
Sequence logo: cdd.1.LGO.gif
Sequence Alignment: cdd.1.ALGN
Solution location in genomic coordinates: 2229735-2229758
Solution sequence with flanking nucleotides: taa AATTTGCGATGCGTCGCGCATTTT tgatg
Number of overlapping basepairs with reported site: 22
Site type: crp
Solution location in genomic coordinates: 2229785-2229808
Solution sequence with flanking nucleotides: cataa TTAATGAGATTCAGATCACATATA aagcc
Number of overlapping basepairs with reported site: 22
Site type: crp
Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 15.42
Model logo: cdd.2.model.LGO.gif
Sequence logo: cdd.2.LGO.gif
Sequence Alignment: cdd.2.ALGN
Solution location in genomic coordinates: 2229765-2229784
Solution sequence with flanking nucleotides: gatgt ATGTTTCACGCGTTGCATAA ttaat
Number of overlapping basepairs with reported site: 18
Site type: cytR
Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.57
Model logo: cdd.3.model.LGO.gif
Sequence logo: cdd.3.LGO.gif
Sequence Alignment: cdd.3.ALGN
Solution location in genomic coordinates: 2229839-2229861
Solution sequence with flanking nucleotides: tatcc CATTACATGATTATGAGGCAACG cc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page