cdsA Gene Page

Genbank name: cdsA
EcoGene name: cdsA
Divergent gene:
Species with an ortholog: AA EC HI PA SP ST TF VC YP
EcoGene link: EG10139

Species that contributed to the solution: AA EC HI PA SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 29.06
Model logo: cdsA.1.model.LGO.gif
Sequence logo: cdsA.1.LGO.gif
Sequence Alignment: cdsA.1.ALGN
Solution location in genomic coordinates: 195679-195702
Solution sequence with flanking nucleotides: ctttt GCTGAAGTATCGCCTGATATCTGC ttttg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI PA SP ST VC YP
Total number of sites in the solution: 11
Number of E. coli sites in the solution: 2
Map value: 29.03
Model logo: cdsA.2.model.LGO.gif
Sequence logo: cdsA.2.LGO.gif
Sequence Alignment: cdsA.2.ALGN
Solution location in genomic coordinates: 195679-195702
Solution sequence with flanking nucleotides: ctttt GCTGAAGTATCGCCTGATATCTGC ttttg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 195709-195732
Solution sequence with flanking nucleotides: tttgt GTTAATACCCGTCGTCATCGCGGC gttgt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 11.43
Model logo: cdsA.3.model.LGO.gif
Sequence logo: cdsA.3.LGO.gif
Sequence Alignment: cdsA.3.ALGN
Solution location in genomic coordinates: 195739-195759
Solution sequence with flanking nucleotides: ttgtt TCTGTTGCCGCCGGTGGGGTT cgcca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 195763-195783
Solution sequence with flanking nucleotides: ttcgc CATTGTAACGCTGGTGGTCTG c
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page