citA Gene Page

Genbank name: citA
EcoGene name: dpiB
Divergent gene: citC
Species with an ortholog: EC   ST   VC   
EcoGene link: EG13646

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 28.27
Model logo: citA.1.model.LGO.gif
Sequence logo: citA.1.LGO.gif
Sequence Alignment: citA.1.ALGN
Solution location in genomic coordinates: 651292-651314
Solution sequence with flanking nucleotides: atgat TTTAAGTTTTTTAATTAATGTAA ttacg
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 651343-651365
Solution sequence with flanking nucleotides: agtga TTTAATTGATTTAATGAATAAAA tttgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.39
Model logo: citA.2.model.LGO.gif
Sequence logo: citA.2.LGO.gif
Sequence Alignment: citA.2.ALGN
Solution location in genomic coordinates: 651213-651230
Solution sequence with flanking nucleotides: tcgct ATACATCCTAAGGAGTAT ttcgg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 6.25
Model logo: citA.3.model.LGO.gif
Sequence logo: citA.3.LGO.gif
Sequence Alignment: citA.3.ALGN
Solution location in genomic coordinates: 651236-651259
Solution sequence with flanking nucleotides: ttcgg CGTGAAATTTTGATTTATTTCACA tagag
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page