clpB Gene Page

Genbank name: clpB
EcoGene name: clpB
Divergent gene:
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP   
EcoGene link: EG10157

Species that contributed to the solution: AA EC HI SP ST TF VC YP
Total number of sites in the solution: 12
Number of E. coli sites in the solution: 2
Map value: 24.81
Model logo: clpB.1.model.LGO.gif
Sequence logo: clpB.1.LGO.gif
Sequence Alignment: clpB.1.ALGN
Solution location in genomic coordinates: 2732241-2732264 R
Solution sequence with flanking nucleotides: gtcaa TAACCTTGAATAATTGAGGGATGA cctca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2732205-2732228 R
Solution sequence with flanking nucleotides: taatc TCCAGTAGCAACTTTGATCCGTTA tggga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 16.16
Model logo: clpB.2.model.LGO.gif
Sequence logo: clpB.2.LGO.gif
Sequence Alignment: clpB.2.ALGN
Solution location in genomic coordinates: 2732275-2732293 R
Solution sequence with flanking nucleotides: acgcg TGATTTTCTTTTCACATTA atctg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 16.15
Model logo: clpB.3.model.LGO.gif
Sequence logo: clpB.3.LGO.gif
Sequence Alignment: clpB.3.ALGN
Solution location in genomic coordinates: 2732298-2732320 R
Solution sequence with flanking nucleotides: taacc TAAAGAATCAAGACGATCCGGTA cgcgt
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page