clpP Gene Page
Genbank name: clpP
EcoGene name: clpP
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG10158
Species that contributed to the solution: EC PA SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 13.57
Model logo: clpP.1.model.LGO.gif
Sequence logo: clpP.1.LGO.gif
Sequence Alignment: clpP.1.ALGN
Solution location in genomic coordinates: 455742-455763
Solution sequence with flanking nucleotides: tggaa CCGTGCGAAAAGCCTCTTTCGG tgtta
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 455842-455863
Solution sequence with flanking nucleotides: ataat CCGTCCATAAGGTTACAATCGG tacag
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.35
Model logo: clpP.2.model.LGO.gif
Sequence logo: clpP.2.LGO.gif
Sequence Alignment: clpP.2.ALGN
Solution location in genomic coordinates: 455784-455805
Solution sequence with flanking nucleotides: aaaag ATTGTTATGCTTGAAATATGGT gatgc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC HI SP VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 10.90
Model logo: clpP.3.model.LGO.gif
Sequence logo: clpP.3.LGO.gif
Sequence Alignment: clpP.3.ALGN
Solution location in genomic coordinates: 455653-455669
Solution sequence with flanking nucleotides: TAATTTACGCAGCATAA cgcgc
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page