clpX Gene Page

Genbank name: clpX
EcoGene name: clpX
Divergent gene:
Species with an ortholog: EC PA SP ST TF VC YP
EcoGene link: EG10159

Species that contributed to the solution: EC PA ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 16.57
Model logo: clpX.1.model.LGO.gif
Sequence logo: clpX.1.LGO.gif
Sequence Alignment: clpX.1.ALGN
Solution location in genomic coordinates: 456550-456573
Solution sequence with flanking nucleotides: cgcta TACTTATCCAGGGCGGCACAACGC tgtaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 456605-456628
Solution sequence with flanking nucleotides: cattt GCGTCGTCGTGTGCGGCACAAAGA acaaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 13.04
Model logo: clpX.2.model.LGO.gif
Sequence logo: clpX.2.LGO.gif
Sequence Alignment: clpX.2.ALGN
Solution location in genomic coordinates: 456525-456546
Solution sequence with flanking nucleotides: tga TGCCAGAGGCGCAACTGTGCCG ctata
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 456580-456601
Solution sequence with flanking nucleotides: gtaag CGGCTTGCGCCTGAGAATGGCA tttgc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC SP ST YP
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 12.81
Model logo: clpX.3.model.LGO.gif
Sequence logo: clpX.3.LGO.gif
Sequence Alignment: clpX.3.ALGN
Solution location in genomic coordinates: 456630-456647
Solution sequence with flanking nucleotides: aagaa CAAAGAAGAGGTTTTGAC cc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page