cls Gene Page

Genbank name: cls
EcoGene name: cls
Divergent gene:
Species with an ortholog: AA   EC   PA   ST   VC   YP   
EcoGene link: EG11608

Species that contributed to the solution: AA EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 15.12
Model logo: cls.1.model.LGO.gif
Sequence logo: cls.1.LGO.gif
Sequence Alignment: cls.1.ALGN
Solution location in genomic coordinates: 1306682-1306705 R
Solution sequence with flanking nucleotides: gtaaa CTCATAACAATGCGCTTTCAAAAG gattt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 2
Map value: 11.83
Model logo: cls.2.model.LGO.gif
Sequence logo: cls.2.LGO.gif
Sequence Alignment: cls.2.ALGN
Solution location in genomic coordinates: 1306864-1306884 R
Solution sequence with flanking nucleotides: ctcaa GCCAACGCGATTTACGTCGGC tagcc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1306840-1306860 R
Solution sequence with flanking nucleotides: gctag CCTGACGCTGCATGCGCCAGC gcccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 11.08
Model logo: cls.3.model.LGO.gif
Sequence logo: cls.3.LGO.gif
Sequence Alignment: cls.3.ALGN
Solution location in genomic coordinates: 1306865-1306888 R
Solution sequence with flanking nucleotides: gcccc TCAAGCCAACGCGATTTACGTCGG ctagc
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 1306681-1306704 R
Solution sequence with flanking nucleotides: taaac TCATAACAATGCGCTTTCAAAAGG atttc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page