cmk Gene Page
Genbank name: cmk
EcoGene name: cmk
Divergent gene:
Species with an ortholog:
AA EC HI PA SP ST TF VC YP
EcoGene link: EG11265
Species that contributed to the solution: EC HI PA SP ST VC YP
Total number of sites in the solution: 9
Number of E. coli sites in the solution: 1
Map value: 14.11
Model logo: cmk.1.model.LGO.gif
Sequence logo: cmk.1.LGO.gif
Sequence Alignment: cmk.1.ALGN
Solution location in genomic coordinates: 960285-960303
Solution sequence with flanking nucleotides: tgcca GCCCGCTATAATTGCGCAA taaat
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC SP ST
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 2
Map value: 11.29
Model logo: cmk.2.model.LGO.gif
Sequence logo: cmk.2.LGO.gif
Sequence Alignment: cmk.2.ALGN
Solution location in genomic coordinates: 960320-960342
Solution sequence with flanking nucleotides: ctgaa TACAGACAAAACTGGTTTTTGCA cacaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 960391-960413
Solution sequence with flanking nucleotides: ggtta TGTTAACGGTACGCCTGTTTTAA ggaga
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 11.20
Model logo: cmk.3.model.LGO.gif
Sequence logo: cmk.3.LGO.gif
Sequence Alignment: cmk.3.ALGN
Solution location in genomic coordinates: 960249-960268
Solution sequence with flanking nucleotides: TAAATCATTGTCATCTTTCG ggctg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page