coaA Gene Page

Genbank name: coaA
EcoGene name: coaA
Divergent gene:
Species with an ortholog: AA EC HI SP ST VC YP
EcoGene link: EG10922

Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 33.45
Model logo: coaA.1.model.LGO.gif
Sequence logo: coaA.1.LGO.gif
Sequence Alignment: coaA.1.ALGN
Solution location in genomic coordinates: 4172619-4172638 R
Solution sequence with flanking nucleotides: gcttt GCCGATAGAGCTATGACCGC cagaa
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI VC
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 28.83
Model logo: coaA.2.model.LGO.gif
Sequence logo: coaA.2.LGO.gif
Sequence Alignment: coaA.2.ALGN
Solution location in genomic coordinates: 4172761-4172783 R
Solution sequence with flanking nucleotides: ttttt ATCAGATGGAATATCTGTCACAT tgctt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST VC
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 1
Map value: 21.87
Model logo: coaA.3.model.LGO.gif
Sequence logo: coaA.3.LGO.gif
Sequence Alignment: coaA.3.ALGN
Solution location in genomic coordinates: 4172715-4172732 R
Solution sequence with flanking nucleotides: gcaga GATTTTTTCTTATTATTC ctccc
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page