codB Gene Page

Genbank name: codB
EcoGene name: codB
Divergent gene:
Species with an ortholog: EC PA ST
EcoGene link: EG11327 Reported site,genomic coordinates and site type: DPInteract 354059:354084 purR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 10.23
Model logo: codB.1.model.LGO.gif
Sequence logo: codB.1.LGO.gif
Sequence Alignment: codB.1.ALGN
Solution location in genomic coordinates: 354095-354115
Solution sequence with flanking nucleotides: gatga ATAGAATGCGGCGGATTTTTT gggtt
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC ST
Total number of sites in the solution: 2
Number of E. coli sites in the solution: 1
Map value: 9.69
Model logo: codB.2.model.LGO.gif
Sequence logo: codB.2.LGO.gif
Sequence Alignment: codB.2.ALGN
Solution location in genomic coordinates: 354064-354079
Solution sequence with flanking nucleotides: tcccc ACGAAAACGATTGCTT tttat
Number of overlapping basepairs with reported site: 16
Site type: purR

Species that contributed to the solution: EC ST
Total number of sites in the solution: 3
Number of E. coli sites in the solution: 2
Map value: 9.57
Model logo: codB.3.model.LGO.gif
Sequence logo: codB.3.LGO.gif
Sequence Alignment: codB.3.ALGN
Solution location in genomic coordinates: 353868-353891
Solution sequence with flanking nucleotides: tgcct GATGCGACGCTGACGCGTTTTATC atgcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP26b Overlap: 24
Solution location in genomic coordinates: 353962-353985
Solution sequence with flanking nucleotides: tgcct GATGCGACGCTGACGCGTCTTATC aggcc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: REP26d Overlap: 24

Gene Index Page