cof Gene Page

---

Species that contributed to the solution: AA EC ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 7.27
Model logo: cof.2.model.LGO.gif
Sequence logo: cof.2.LGO.gif
Sequence Alignment: cof.2.ALGN
Solution location in genomic coordinates: 466537-466552
Solution sequence with flanking nucleotides: ATAAACCCGGAACAAT attat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 466582-466597
Solution sequence with flanking nucleotides: tccgt ATATATCAGGTGATAC tcaat
Number of overlapping basepairs with reported site: 0
Site type:

---

Species that contributed to the solution: AA EC HI ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 6.49
Model logo: cof.3.model.LGO.gif
Sequence logo: cof.3.LGO.gif
Sequence Alignment: cof.3.ALGN
Solution location in genomic coordinates: 466600-466620
Solution sequence with flanking nucleotides: tactc AATCACCATTAACCGTGTCAC aga
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page