corA Gene Page

Genbank name: corA
EcoGene name: corA
Divergent gene: yigE
Species with an ortholog: AA   EC   HI   PA   SP   ST   YP   
EcoGene link: EG11463

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 27.12
Model logo: corA.1.model.LGO.gif
Sequence logo: corA.1.LGO.gif
Sequence Alignment: corA.1.ALGN
Solution location in genomic coordinates: 3998952-3998974
Solution sequence with flanking nucleotides: gctga GTCAGGCTGTTTAATGGTCTGAA accca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3999006-3999028
Solution sequence with flanking nucleotides: gaact GTCCGATATTTTAAGCATTGGGA gtccc
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 23.94
Model logo: corA.2.model.LGO.gif
Sequence logo: corA.2.LGO.gif
Sequence Alignment: corA.2.ALGN
Solution location in genomic coordinates: 3998825-3998847
Solution sequence with flanking nucleotides: gacat TCGCCTTGGACACACCCAGTAGA tactg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC HI SP ST YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 21.70
Model logo: corA.3.model.LGO.gif
Sequence logo: corA.3.LGO.gif
Sequence Alignment: corA.3.ALGN
Solution location in genomic coordinates: 3998769-3998792
Solution sequence with flanking nucleotides: gcgtg TTGACGGCAAAATTTTGCTGGCGT aacat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 3998898-3998921
Solution sequence with flanking nucleotides: ccctt TTTGCTGATAGCCTTAGCGGTTGT cagcg
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: yigE_corA_IR     Overlap: 23


Gene Index Page