cpdB Gene Page

Genbank name: cpdB
EcoGene name: cpdB
Divergent gene: cysQ
Species with an ortholog: AA EC HI SP ST VC YP
EcoGene link: EG10160

Species that contributed to the solution: EC HI SP ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 2
Map value: 13.67
Model logo: cpdB.1.model.LGO.gif
Sequence logo: cpdB.1.LGO.gif
Sequence Alignment: cpdB.1.ALGN
Solution location in genomic coordinates: 4434272-4434292 R
Solution sequence with flanking nucleotides: ttgtt TTACTTATACCCTATCGTTAA tgaat
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 4434156-4434176 R
Solution sequence with flanking nucleotides: ttttc TTTCGTATTCCCGATGATAAA aggat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 1
Map value: 10.26
Model logo: cpdB.2.model.LGO.gif
Sequence logo: cpdB.2.LGO.gif
Sequence Alignment: cpdB.2.ALGN
Solution location in genomic coordinates: 4434193-4434210 R
Solution sequence with flanking nucleotides: ttcac TGTTCTATAAGTAAGACG tttat
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: AA EC SP ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 8.30
Model logo: cpdB.3.model.LGO.gif
Sequence logo: cpdB.3.LGO.gif
Sequence Alignment: cpdB.3.ALGN
Solution location in genomic coordinates: 4434235-4434258 R
Solution sequence with flanking nucleotides: ccaac TGTGATAGTGTCATCATTTTCAAA gcgta
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page