cpsG Gene Page
Genbank name: cpsG
EcoGene name: cpsG
Divergent gene:
Species with an ortholog:
AA EC PA SP ST TF YP
EcoGene link: EG10162
Species that contributed to the solution: EC SP ST TF YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.27
Model logo: cpsG.1.model.LGO.gif
Sequence logo: cpsG.1.LGO.gif
Sequence Alignment: cpsG.1.ALGN
Solution location in genomic coordinates: 2121015-2121036 R
Solution sequence with flanking nucleotides: ttcgg TCAGGGCCAACTATTGCCTGAA aaagg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC PA SP ST TF YP
Total number of sites in the solution: 10
Number of E. coli sites in the solution: 2
Map value: 9.32
Model logo: cpsG.2.model.LGO.gif
Sequence logo: cpsG.2.LGO.gif
Sequence Alignment: cpsG.2.ALGN
Solution location in genomic coordinates: 2121055-2121076 R
Solution sequence with flanking nucleotides: aaacc GCGGTGTAAATAACGACAAAAA taaaa
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 2121015-2121036 R
Solution sequence with flanking nucleotides: ttcgg TCAGGGCCAACTATTGCCTGAA aaagg
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: AA EC PA SP ST TF
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 4.55
Model logo: cpsG.3.model.LGO.gif
Sequence logo: cpsG.3.LGO.gif
Sequence Alignment: cpsG.3.ALGN
Solution location in genomic coordinates: 2121078-2121100 R
Solution sequence with flanking nucleotides: acgtc GCATCAGGCAATGAATGCGAAAC cgcgg
Number of overlapping basepairs with reported site: 0
Site type:
Gene Index Page