cpxR Gene Page

Genbank name: cpxR
EcoGene name: cpxR
Divergent gene: cpxP
Species with an ortholog: AA   EC   HI   PA   SP   ST   TF   VC   YP
EcoGene link: EG10020    Reported site,genomic coordinates and site type: DPInteract 4103327:4103341 cpxR
   Reported site,genomic coordinates and site type: DPInteract 4103307:4103321 cpxR

Species that contributed to the solution: AA EC HI ST YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 18.59
Model logo: cpxR.1.model.LGO.gif
Sequence logo: cpxR.1.LGO.gif
Sequence Alignment: cpxR.1.ALGN
Solution location in genomic coordinates: 4103294-4103311 R
Solution sequence with flanking nucleotides: acaac GTAAAGTCATGGATTAGC gacgt
Number of overlapping basepairs with reported site: 5
Site type: cpxR

Species that contributed to the solution: AA EC SP ST VC
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 12.14
Model logo: cpxR.2.model.LGO.gif
Sequence logo: cpxR.2.LGO.gif
Sequence Alignment: cpxR.2.ALGN
Solution location in genomic coordinates: 4103335-4103358 R
Solution sequence with flanking nucleotides: tagag AGTTTACGATTCAGGCTGCAAACA tgcgt
Number of overlapping basepairs with reported site: 7
Site type: cpxR

Species that contributed to the solution: AA EC ST VC YP
Total number of sites in the solution: 6
Number of E. coli sites in the solution: 1
Map value: 11.65
Model logo: cpxR.3.model.LGO.gif
Sequence logo: cpxR.3.LGO.gif
Sequence Alignment: cpxR.3.ALGN
Solution location in genomic coordinates: 4103270-4103292 R
Solution sequence with flanking nucleotides: tagcg ACGTCTGATGACGTAATTTCTGC ctcgg
Number of overlapping basepairs with reported site: 0
Site type:

Gene Index Page