crp Gene Page
Genbank name: crp
EcoGene name: crp
Divergent gene: yhfA
Species with an ortholog:
AA EC HI PA SP ST VC YP
EcoGene link: EG10164
Reported site,genomic coordinates and site type: DPInteract 3483621:3483642 crp
Reported site,genomic coordinates and site type: DPInteract 3483519:3483540 crp
Reported site,genomic coordinates and site type: PMID:9582281 3483491:3483506 fis
Reported site,genomic coordinates and site type: PMID:9582281 3483612:3483627 fis
Reported site,genomic coordinates and site type: PMID:9582281 3483631:3483645 fis
Reported site,genomic coordinates and site type: PMID:9582281 3483650:3483666 fis
Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 18.08
Model logo: crp.1.model.LGO.gif
Sequence logo: crp.1.LGO.gif
Sequence Alignment: crp.1.ALGN
Solution location in genomic coordinates: 3483703-3483719
Solution sequence with flanking nucleotides: tccag AGACAGCGGCGTTATCT ggctc
Number of overlapping basepairs with reported site: 0
Site type:
Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 5
Number of E. coli sites in the solution: 1
Map value: 17.03
Model logo: crp.2.model.LGO.gif
Sequence logo: crp.2.LGO.gif
Sequence Alignment: crp.2.ALGN
Solution location in genomic coordinates: 3483533-3483556
Solution sequence with flanking nucleotides: ctggg TCATGCTGAAGCGAGACACCAGGA gacac
Number of overlapping basepairs with reported site: 8
Site type: crp
Species that contributed to the solution: AA EC HI ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 1
Map value: 17.02
Model logo: crp.3.model.LGO.gif
Sequence logo: crp.3.LGO.gif
Sequence Alignment: crp.3.ALGN
Solution location in genomic coordinates: 3483595-3483614
Solution sequence with flanking nucleotides: gatgc TACAGTAATACATTGATGTA ctgca
Number of overlapping basepairs with reported site: 3
Site type: fis
Gene Index Page