cspD Gene Page

Genbank name: cspD
EcoGene name: cspD
Divergent gene: yljA
Species with an ortholog: EC   HI   PA   SP   ST   VC   YP   
EcoGene link: EG11111

Species that contributed to the solution: EC ST
Total number of sites in the solution: 4
Number of E. coli sites in the solution: 2
Map value: 21.06
Model logo: cspD.1.model.LGO.gif
Sequence logo: cspD.1.LGO.gif
Sequence Alignment: cspD.1.ALGN
Solution location in genomic coordinates: 922034-922051 R
Solution sequence with flanking nucleotides: tccac ATGATAGATAACTATCAT ctatc
Number of overlapping basepairs with reported site: 0
Site type:
Repeat: cspD_yljA_IR     Overlap: 18
Solution location in genomic coordinates: 921833-921850 R
Solution sequence with flanking nucleotides: attcc ATCTTACTTGTATAAGAT ttgcg
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC HI SP ST VC YP
Total number of sites in the solution: 7
Number of E. coli sites in the solution: 1
Map value: 13.61
Model logo: cspD.2.model.LGO.gif
Sequence logo: cspD.2.LGO.gif
Sequence Alignment: cspD.2.ALGN
Solution location in genomic coordinates: 921902-921919 R
Solution sequence with flanking nucleotides: cccta ATTCTCTAAATTGTATTT ctaga
Number of overlapping basepairs with reported site: 0
Site type:

Species that contributed to the solution: EC PA ST VC YP
Total number of sites in the solution: 8
Number of E. coli sites in the solution: 2
Map value: 13.34
Model logo: cspD.3.model.LGO.gif
Sequence logo: cspD.3.LGO.gif
Sequence Alignment: cspD.3.ALGN
Solution location in genomic coordinates: 922009-922032 R
Solution sequence with flanking nucleotides: tcatc TATCGTTGGCATCAGCGACATCTG tcaca
Number of overlapping basepairs with reported site: 0
Site type:
Solution location in genomic coordinates: 921970-921993 R
Solution sequence with flanking nucleotides: gtcaa TAGCGTTAACTGCTTCAAATTTTT gattc
Number of overlapping basepairs with reported site: 0
Site type:


Gene Index Page